Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YP06FM1
Length(NT) : 177
Best Gene Model Blast : Link to GSTUMT00011784001 E-value : 4e-94
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_14357
Accession: ref|XP_001804547.1| Score: 131 E_value: 2e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD57YP06FM1
TTGGCTTAGGACTACGGAGTGGCAGTTGTTTGGCGGCATGTATTCTAATG
CGTGTAGGTAGAGGGGTGTTGCCAGGAAGAAGCGGTTTGTGGATTCGTAG
ACGCTTGCGAGGGTTTCTAGCAGGGAGGACATTTCCAAGTTTGATAGCCA
GTCTTGGTGGAGTTCTTGTCTGGGGGA

Sequences in the Contig:

SY0AAD57YP06FM1