Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YO06FM1
Length(NT) : 578
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 206 E_value: 4e-19
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 222 E_value: 4e-17
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 145 E_value: 2e-10
PFAM Definition: No Hit Found
Swissprot: Q8IWZ3|ANKH1_HUMAN

Sequence:
>SY0AAD57YO06FM1
TTGGACTTTTTGCCCAAGCGAAGCACTTCCATCTCCGGAGTTTTGATGGC
CTCCCTCTGTTCAGCTGACTGCACAGCGCATCGTTCTTGGGAATTTTTGA
GGTATAGCTGGTGTAATATCAATGGAATGTTATGATATCAATGACATGGG
TTTTTCGGGTTGTGGGCCGCTTGGATGGGCACTCGGAATGGACATGAGGG
AGTGGTGAAAACACTGCTCGGGCAGGGAGGGATCAGCTCTGATATGCTAG
ATAATGACGGGGAACACCGCTCTCGTTTGCCGCTGAGGGTGGACGCGAGG
AAGTGGTGAAAATATTACTCGGACGAGAAGAGCTCAATCCCGACAAGCCG
AATAACAGCGGCCGAACACCGCTTTCTGTTGTCGCTCAGAATGGACATAA
GGGAGTAGTGAAAATTCCACTCAGACGGGAAGAGGTCAATCCCAACGGGC
CAGATAATGATGGTCGAACACCGCTTTCCCGTGCAGCTTGTTTTGGACAT
GAGGGAGTTGTAAAAAATACTCCTCGGATGGGAAGAGGTCAACCCTGGCA
AGACGAATAATCACAGCCAAATACCACT

Sequences in the Contig:

SY0AAD57YO06FM1