Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YN23FM1
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00010342001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_12995
Accession: ref|XP_001548600.1| Score: 267 E_value: 4e-22
KEGG Definition: hypothetical protein
Accession: ncr:NCU04587.1 Score: 256 E_value: 4e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O94263|DPB2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0003688 = Molecular function: DNA replication origin binding
GO:0005515 = Molecular function: protein binding
GO:0006270 = Biological process: DNA replication initiation

Sequence:
>SY0AAD57YN23FM1
TTGGCCGAAAATGCCTCTCGATAAAGGAAAATCGAAACTTCCCACCTTCT
TCAGGCCTAAATTCCCCTGGGCCACGCCAAACCCCTCATCACAGCAAACC
TCTGATCCTTACGAGCCACTCCCACAATCCACACGACCGCAAACACCCCG
AATATTAGCTGTCGAGATCCCCCTAAATGTGCTCCGGCCGGTTGCGTTCA
GAGTTTTTACAAAGAAACACAACTTGACACTCAAGTCCGATGCGCTAGCA
CTATTGTGCTCTTTTGTCGGGCGGCGGTGTGGCGCCGAGTGGAGGGATAG
CGGTGCGGGAGAAAAGCTGCTGGACGAGGTAGCCCGGCAATGGCGACGCA
ATGAGGGTGCCAATGGGGTGTTAGTTGATGGAGGGGAGGGACTGAAGAGT
GTTATAAGGGGGCTGGAAGTCGGTGGCGATTCAGTGGGCCTGAGTAGGGA
GAAAAGTTTCGATATAACTGAGGTACCGTCGAGTGCGTTGTACGGCGGCG
GGGCGGGTATGGATGACATTGCAGCAGCAGCGGATGCTGGCGAGCTGGAG
GATGT

Sequences in the Contig:

SY0AAD57YN23FM1