Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YM22FM1
Length(NT) : 564
Best Gene Model Blast : Link to GSTUMT00011008001 E-value : 1e-154
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN3755.2
Accession: ref|XP_661359.1| Score: 221 E_value: 9e-17
KEGG Definition: hypothetical protein
Accession: ani:AN3755.2 Score: 221 E_value: 5e-17
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1674 Score: 113 E_value: 9e-07
PFAM Definition: No Hit Found
Swissprot: P40186|PCL7_YEAST
Gene Ontology:
GO:0000307 = Cellular component: cyclin-dependent protein kinase holoenzyme complex
GO:0005634 = Cellular component: nucleus
GO:0016538 = Molecular function: cyclin-dependent protein kinase regulator activity
GO:0005515 = Molecular function: protein binding
GO:0005979 = Biological process: regulation of glycogen biosynthetic process
GO:0005981 = Biological process: regulation of glycogen catabolic process

Sequence:
>SY0AAD57YM22FM1
TTGGGCGGTCTCCCACTAGCCGAACTAAACCACCTAGAACTACAGTTCCT
CATCCTAAACGACTTTCGCCTCTCGGTGCCCGTGGAAGAGTTAGAAGCCT
ATGGAACCATGCTCGTGCAGTTTTACGCTAGGGAGGCGGTGTCCAGTGCG
AACCTTTTAGATAATAACGTTAATCCGCCCCCCACTCCCCTTCCACAGCC
TCCGACACAGCCCCCGACACAGCCCGCAACAGTAGAAACGGAGACACCGC
GCGTGGAGAATAGTATTATGGCCTAGGGGGTGCGAGATACTGGAATTGAT
GCTTGCTTGCATGTGTAGAGAAGGGTAGAATTTGGGATGGTTGTAGTAGA
AGGTTATTGAGGAGTTTGCGGGAGGGTTTATTTTTCTGTTTCTATCATTT
CATTTCACTCATTCTCTCTCGTTCTCTCTTAATACGGCATGGCACTTCAA
CCTCAACCTCGGACTCAAACATGGACACGGATTCGTTGGCTGCATGGGAA
TTTTAAATAAAGGCGTCTTTTTTATATTTATTTCGTTTCATTACCAGGTT
TATACAGCCACTCG

Sequences in the Contig:

SY0AAD57YM22FM1