Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YL18FM1
Length(NT) : 566
Best Gene Model Blast : Link to GSTUMT00007395001 E-value : 1e-156
Numbers of ESTs : 1

Blast Results:

Nr Definition: 6-phosphofructo-2-kinase
Accession: ref|XP_001248706.1| Score: 384 E_value: 6e-44
KEGG Definition: fructose-6-phosphate 2-kinase/fructose-2, 6-biphosphatase [EC:2.7.1.105]; K00900 6-phosphofructo-2-kinase
Accession: aor:AO090012000976 Score: 358 E_value: 1e-41
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0234 Score: 269 E_value: 7e-25
PFAM Definition: No Hit Found
Swissprot: Q8TFH0|YIKE_SCHPO
Gene Ontology:
GO:0003873 = Molecular function: 6-phosphofructo-2-kinase activity

Sequence:
>SY0AAD57YL18FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCTACGACGAAATCAAGAG
TCAATATCCCCAAGAATACGATTTGCGTCGCCGTGACAAACTACATTACC
GTTACCCTGGGGCCGGTGGCGAGTCTTATTTAGATGTTATCAACCGCCTT
CGCGCCGTAATTGTGGAGGTTGAACGGATGACAGATCACGTCTTGTTGAT
TGGTCACCGCGTAGTTGCTAGGGTTTTGCTAGCTTACTTTCTTGGCCTCG
AGAGGGAAGACGTTGCCAAGCTCGACGTTCCTCTGGGAACTATCTACGTT
CTTGAGCCGGTATAATCCCTATTGCCTTTGAACCCTTACTGTGCTAACGG
AGGTTCAGAAACCGTACGGCGTTGAATTCCGGGCCTACAAATACAACTCA
GAAACCGAATGGTTCGACTTTCAGCCAGATTTCAAACTCAAAAATGAAGA
ACAAAAAGACATAAAAGTGAATGTTAAGGTCGCCATGAGCACCTAAAGCC
CTTGGATTTTCTTGTTTCCTCTTCTCTTAAGTTCTAAACTCTCCACTTTA
CTTTCTGCTTCGCGTT

Sequences in the Contig:

SY0AAD57YL18FM1