Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YL09FM1
Length(NT) : 456
Best Gene Model Blast : Link to GSTUMT00010237001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61234.1| Score: 185 E_value: 9e-13
KEGG Definition: uncharacterized conserved protein
Accession: aor:AO090102000131 Score: 185 E_value: 4e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD57YL09FM1
TTGGATGATGTGTTCGATCACGGTACTCCCGATTTTTGCTCCCTTCAGGT
GGCTTGCTCGAAGGTTGATTCAGCCCGGAGAAGGTCCTACGGCTGAGCAG
ATGGAAAAGTACAGAATGGAATACCGAGGAGTAGCGGAGGCTGACGACGA
TAGTGAAGATCCTAAAAAGGTTTTTGTGAGACTTACGTATGAAAAGGACC
CATACACATGCACCGGAGCCTTGATGGTACAGTTCGCCATGAGTATCCTA
TTTGATGAGGGCATCGAGGCGAGGAAATTGGGCTGTGGTATGCTCACTAC
TGCTACTGTTGCCACCCCAGAGTTTTATAGGAATTTGGATAGGGCTGGAT
TTTGCATAGAAACAAAATTGCTGTGAAGGAGGAACCGGCCCAGTTTACTT
AGGAATTGTGTAGTCTAGGTTTTTAGGACTGCTCAATCAAGCTTATGATA
GTTGGT

Sequences in the Contig:

SY0AAD57YL09FM1