Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YL03FM1
Length(NT) : 652
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_00298
Accession: ref|XP_001561213.1| Score: 552 E_value: 5e-55
KEGG Definition: dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases)
Accession: aor:AO090023000688 Score: 417 E_value: 1e-39
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1205 Score: 145 E_value: 3e-10
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 153 E_value: 3e-11
Swissprot: O93868|MTDH_AGABI
Gene Ontology:
GO:0050085 = Molecular function: mannitol 2-dehydrogenase (NADP+) activity

Sequence:
>SY0AAD57YL03FM1
TTGGAAACTTCAAGCTTCTACTTGCCTTTGCTTTTCCCTTCCTACATTGA
CATCCAACGTCTGTACACAAACAATAACCTCGTTTTCTACAATTACGGAG
TATAATTACAATGAAGTCCTCCATCCTCCGCCCCCTCCTCACCACCACAA
CCCGCACAACTCTACGACAGTCCCTCCGAACACAAAACATCGTCCGCAAT
GCAAAACTTTCCACAACGACGTGTAGAAGAGTAGAGGCTCGCAATCCCCC
ATCACCACCAGAAGCGGAATCAATTGCGCTTAAAAAAGGCGACCCACCCA
CATATTTAGGAACCGCTAAAAGATTACCGGAGTTCAATTTGGTAGATAAA
GTTGTTTGTGTTTCGGGTGCGGGGAGAGGACTGGGATTGGTGCAGGCCGA
GGCGCTGTTGGAAGCTGGTGCTACTGTATACGCACTTGACCGCCTCGAAA
CTCCCTCCCCAGACTTCGCGCGAGTCCAAGAACGCGCAAAAAACGAACTT
GGCACAACCCTCACGTACCACCGCATCGATGTCCGAGACGTTGACGAACT
AAACCAAATAGTCAAATCCATAGCTGACAAACATGGCCGTCTTGATGGAC
TCATAGCAGCCGCTGGTATCCAACAGGAAACTCCTGCCTTGGATTATACA
GC

Sequences in the Contig:

SY0AAD57YL03FM1