Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YK12FM1
Length(NT) : 548
Best Gene Model Blast : Link to GSTUMT00012283001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_06112
Accession: ref|XP_001242216.1| Score: 372 E_value: 3e-34
KEGG Definition: acetyltransferase, GNAT family, putative [EC:2.3.1.-]; K00680
Accession: afm:AFUA_1G17080 Score: 335 E_value: 3e-30
KOG Definition: No Hit Found
PFAM Definition: Acetyltransf_1, Acetyltransferase (GNAT) family. This family contains proteins with N-acetyltransferase functions such as Elp3-related proteins..
Pfam Number: pfam00583 Score: 108 E_value: 4e-06
Swissprot: P0A0M9|Y995_STAA8

Sequence:
>SY0AAD57YK12FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCGAGTCTAGCCAACCAA
ATTCCTAGACCTTCGGGATCCTCATCCACAAACCCTTATGCATGAGCCCC
TCCTCATCCCACTCCCCCATGCTCTCATCAACCACAAACCCCGCCCTCTC
CCACAACCTCACAACCCTGGTCTGCGCATGCACCAAACACATCCTATTCC
ACGCTGACCCGTCATCCCCAGTAAATTCCTTCCTGGCAGCCCACTCAACC
GCCGCATCGATCAATTTCCTCCCAACCCCATGTCCCCGATAAACTTTTGA
CGTAGCCCACCGTCCCAGCTTCAGGTAATTTGCGTGCTCCTGTCCAACAG
GGATGGGGCCGCCGGGATGGTGTCTTTGGGGGCCTGGGACTATTCGGATG
GTCCCGATGGGCACTCTCTCTGAGGCGTCAGCGTCAGAGTCGTAGGCTAC
TATGTGGTAGCTGCGCTTGTCGTCGTCGTCAAGTTCGTTTTCTGCTGCGA
CGCCTTGCTCTTCCACGAAGACTTCCTTTCGAATAACCATTGCATCTT

Sequences in the Contig:

SY0AAD57YK12FM1