Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YJ15FM1
Length(NT) : 500
Best Gene Model Blast : Link to GSTUMT00011126001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10261
Accession: ref|XP_001551435.1| Score: 300 E_value: 4e-26
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG01893.1 Score: 276 E_value: 1e-23
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1062 Score: 152 E_value: 3e-11
PFAM Definition: Alpha_adaptinC2, Adaptin C-terminal domain. Alpha adaptin is a heterotetramer which regulates clathrin-bud formation. The carboxyl-terminal appendage of the alpha subunit regulates translocation of endocytic accessory proteins to the bud site. This ig-fold domain is found in alpha, beta and gamma adaptins..
Pfam Number: pfam02883 Score: 186 E_value: 2e-15
Swissprot: Q99128|AP1G1_USTMA

Sequence:
>SY0AAD57YJ15FM1
TTGGGGCTCAACCTCAGCCCCATCTGTTGCTCCGAGTCCACCTAAGAGCG
ACGGTGCTGACTGTTGTGGGGCTGCAGCTGGTGCTGGTGAGGATGTTGCT
GGGGCGTTGAATAGGTCCATCTGTTGCTCCGACCGCTGCTCCAGTTGCGG
CGCAGGTTTACAATAAGAACGGTCTTCAAATAACCCTGCAGCTGGCACGT
ACGGCCGATGGCATAATCAGTATCATCGCCCGATTCAAGAACAACTCCTT
TACAGACCGTATCACCAGTGTAAGTCTCCAGGCAGCCGTTCCGAGGAGTA
TGAGGCTTCAGTTGCAAACCATAAGTGACTCAGAGCTTGATCCAGACGCC
GAGGCTACCCAAATGATGAGGGTTGCAGGGAACAGGGGCAGTCCATTGAA
AATGAGGCTGAAGATTGGCTATGTAAAGGACGATGTAGGGGATATCATGG
ATATGGTCGATTGGGCTGAGTCTTCCTAATTTATGAATGAACTGTTGTTC

Sequences in the Contig:

SY0AAD57YJ15FM1