Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YJ02FM1
Length(NT) : 557
Best Gene Model Blast : Link to GSTUMT00010118001 E-value : 1e-142
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_11441
Accession: ref|XP_001587449.1| Score: 204 E_value: 4e-27
KEGG Definition: hypothetical protein
Accession: ang:An18g02170 Score: 199 E_value: 5e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD57YJ02FM1
TTGGGATACTTACTGCCGATTTCCCCGCCATATATAATTTCCATTTACCT
TACTTTAATCTCTCCCCTTCCCCTTTTTCACTGATTGCCTACCATGGGGT
TGGTAAGTCAACTCGTTCGGCGGATTCCCTCGAAAGCTGCCATTCCTTCA
CTTGAAGATATTTCTAAGGGCCGCCTTCCATCCCGGTTATCATTTCTGCG
GCGGCGTATACGGTTAAAAGGAAATTCATCGATATCTGTACCGCTGGGGG
TCGTGTTGTTGTTCCCAATGACGGTAGTTCTACTCATAATGCTTTTGTTT
TCTCGACATCCGGATAATCGTACTTCCATCTTGATCCCTTCGGGCTCCCC
CCCTGCGATAAGGTAACATTTCATTCTTATCCCATCGTTAAGAAGCGATT
GACCAGCGGTATGCGCTCTAAATCTAACTATCTCTACAGAAGAATTTCGG
AAGCCTATGATAAACCCTTCGTTGTTGGGTGTTTAGAACCGGTAACGGAT
ACCCCTCGAGTAAATGCAGCATTTGTTGTGTTGGCTAGAAATAGCGAGTT
GGAGGGC

Sequences in the Contig:

SY0AAD57YJ02FM1