Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YI24FM1
Length(NT) : 465
Best Gene Model Blast : Link to GSTUMT00006178001 E-value : 6e-55
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein HCAG_06913
Accession: ref|XP_001539308.1| Score: 180 E_value: 3e-12
KEGG Definition: hypothetical protein
Accession: yli:YALI0D08250g Score: 148 E_value: 8e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD57YI24FM1
TTGGCGAGGGTCGAGATCGATGCGAAAATTCATGCTGGGTACTTTACCAC
TGGTAAGGTTATGACAATGGAGGAGCTCAGCGCAGTCCAAGGACGTGCGT
GGGACGACGTGGATCACTAGGAAGGCTTACATACATATGTGGCCCTCTTG
GAGTACATAGCGGGTAGGGGTTTTTTTCCCCTCCGATCCCTAAGCATTTC
CACGATCTTGGGATTCCCAAGTACCTTTTGCTGGCACCGGCTGACTGTTC
AAAAGGGCTCCCAGTTTCTTTCAATTTTTCTCTGGAGCGCATGCCCCGCC
AAATCCCCGTGGTTTCTTAATTCCCGGTGTGACGTCGTATGTAAGGCGGA
TCTTGCTGTAACCTGGTACTCCAGATCCCCCCTCTCCCCCATTGTTTTTC
CCCATTGTTTTTTCACTTCGGTTTCCGCATTTGCATAAAGTCCCTCCCGC
TCCAAATTCGATTTA

Sequences in the Contig:

SY0AAD57YI24FM1