Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YG21FM1
Length(NT) : 497
Best Gene Model Blast : Link to GSTUMT00000938001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_00540
Accession: ref|XP_001246769.1| Score: 405 E_value: 3e-38
KEGG Definition: hypothetical protein
Accession: ang:An11g10710 Score: 390 E_value: 8e-37
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1856 Score: 321 E_value: 7e-31
PFAM Definition: No Hit Found
Swissprot: Q4WWH6|SPT6_ASPFU

Sequence:
>SY0AAD57YG21FM1
ATTCACTATGCTCACTGGTGAGACGAAAGAGACATTGGCCGCCGGCATGG
TCGTTCCAGTTGCCATTAGGCGAGTTACGGATAGGTATTGTGCTGTTCGG
CTCGCCTGCGGAATAGATGGAAATGTCTCATTGGATGAGATGCACGATGG
CTCTTCTCATTTTCTCCCAACCAATTTCTACCATGTTGGACAGACGGTAC
AGGCGAGGATTGAAAAGCTTAATGAGGAAACCTTTTTCTCAGAACTCTCC
TTCCGCGAAGACAAGATTAGGAACCCATTGGTCAAGCGGATCGAGTTCTT
ACCTGACGAATGGGATGATGTACGGGAGGAGCGAGACAAAGCAAGATTGT
CAGTGGTCAACCAGGAGCAGACACGCACAGCCAGGGTTATAAAACATCCC
CTTTTTAAACCGTACAACAGCAGGCAAGCGCAGGAATTCCTAGCTGGCCA
ATCTCGCGGCGATGCTATCATTCGGCCCTCTTCCAATGGTCCGGACC

Sequences in the Contig:

SY0AAD57YG21FM1