Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YG16FM1
Length(NT) : 473
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59031.1| Score: 127 E_value: 5e-06
KEGG Definition: nucleoside phosphorylase
Accession: aor:AO090023000490 Score: 127 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD57YG16FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAAAATGTCGCTGTTGCTT
GTTTTTAATTTGACTTCACAGTCCAAAATGACCGGTCCTCCACGAATATG
CTGGGCGCCCTGCTCAAGCAGGTCGTTGGCGGAATGGAAGGGGTACCGGG
GGAAATAGTGGAAGCCTATGAGGACCAAAGAAAAGTGATTGGTGGGAGGG
GACCGCAGCTTGCAGATATTGTAAATATGCTACAGACCACCTCTTCTGAA
AAGCGTACCTTCATATGCATCGATGCTGTGGACGAATGTGGGCTAGGGCA
TCGGGTTAAGCTTCTGGATTCGCTAAACAAAATTCTGCAAAATTCTCCAG
GCACACGAATATTCGTGACTGGAAGGTCACACATTCGACGAGAGATCGGA
AGGCGTCTTACTGGAAGAGTAGGGAGTGTATCGGTCACCCCTAGAAGAGG
TGATATCATCAGTTATCTTCGCA

Sequences in the Contig:

SY0AAD57YG16FM1