Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YF06FM1
Length(NT) : 591
Best Gene Model Blast : Link to GSTUMT00006258001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213851.1| Score: 382 E_value: 2e-35
KEGG Definition: hypothetical protein
Accession: ani:AN2905.2 Score: 372 E_value: 2e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD57YF06FM1
TTGGAGACAGTTTGGCTAAGTTGCTTGCTCGGGATGAGCCCAATCGTGCC
TTTTATCGTACAATATTCCTTTCGGAGTCCTCGACAACACCTTCCTACGA
TCTTCTCACTCGATCATTCGCCCTGGCAATATCTCCAATTCCTGATAACA
TGAAGGTCGCGCTTCCCCAAGCCGTAGAGGCACGGAAACCTTTCTTAGAA
CAAGGAATGCTTGCTGCTGAGATTCTTGCTGGAATTGCACCTGGCCCCGA
TCAAGGCGTAGCCCGCTCCTGGTTATCCTCCGAGGATGGATTTGCGCTCA
GCCTACTGCGACTCGTCTGCTTGCTGAGTCCTCAAGTGACCCCAATGCAC
CCCCGTCAGTCGGGCCAAACTGGAAAGATGCCTAATCTCGATGATTCGCA
ACCCTTTGCGAGAATCACGCATCGGGGCATGGGTGTCTTACAAAAGCTGG
CGGAAAAATCTGGAGATGCAGCTGGTGATCATTCGAAAATACCTCTTGGA
GTTTTACCGAAGAAGGAGAGTCTTTTGGGAGCATTGTTGACGGTTCAGAT
AGATGGAGTTATTGTCAAAAAGCTTTGTACTTATGCCGGGT

Sequences in the Contig:

SY0AAD57YF06FM1