Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD57YB17FM1
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00010659001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_00450
Accession: ref|XP_001791135.1| Score: 1162 E_value: 1e-125
KEGG Definition: U5 snRNP spliceosome subunit
Accession: aor:AO090026000655 Score: 1156 E_value: 1e-125
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1795 Score: 1123 E_value: 1e-123
PFAM Definition: PROCN, PROCN (NUC071) domain. The PROCN domain is the central domain in pre-mRNA splicing factors of PRO8 family..
Pfam Number: pfam08083 Score: 909 E_value: 6e-99
Swissprot: Q6P2Q9|PRP8_HUMAN
Gene Ontology:
GO:0005682 = Cellular component: snRNP U5
GO:0005515 = Molecular function: protein binding
GO:0031202 = Molecular function: RNA splicing factor activity, transesterification mechanism
GO:0006397 = Biological process: mRNA processing
GO:0008380 = Biological process: RNA splicing

Sequence:
>SY0AAD57YB17FM1
TTGGCCTGGATGCGGATTTTGGGCACCAGCTTGGAGGGTCTGGCTCTTCT
TCATGCGAGGTATCCTCCCATTATTGGAGAGATGGCTCGGGAACCTGTTG
GCAAGACAATTCGAGGGACGTCATAGCAAAGGGGTTGCTAAAACTGTTAC
GAAACAAAGGGTGGAATCTCATTTCGATTTGGAATTGAGGGCAGCTGTCA
TCCATGACATCACGGATATGATGCCGGCTGGCATGAAGTCGAATAAGGTC
AATACGGTTTTGCAGCATCTTAGTGAAGCATGGAGATGTTGGAAGAGTAA
CATTCCCTGGAAGGTCCCCGGTCTTCCCGCGCCAATTGAAAATGTCATTT
TGCGATATGTCAAAAGCAAGGCCGATTGGTGGGTAAGCGTCGCCCACTAT
AATAGGGAGCGTATTCGGAGAGGCGCCACTGTCGACAAGACTGTGGCTAA
GAAGAACTTGGGGAGGTTGACACGTCTTTGGTTGAAAGCCGAGCAAGAGA
GACAGCACAATTACATGAAGGACGGGCCATACGTCTCCTCAGAAGAAGCC
GTTGCAATCTACACTGCCGCAGTTCATTGGTTGGAGGCTAGGAAGTTTTC
TCCAATTCCATTTCCTAGCGTTTCTTACAAGCATGACACTAAAATCCTGA
TTCTCGCTCTCGAAAGATTGAGGGAGGCATATT

Sequences in the Contig:

SY0AAD57YB17FM1