Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YO21FM1
Length(NT) : 471
Best Gene Model Blast : Link to GSTUMT00008693001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG07053.1
Accession: ref|XP_387229.1| Score: 192 E_value: 8e-21
KEGG Definition: hypothetical protein
Accession: fgr:FG07053.1 Score: 192 E_value: 4e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD56YO21FM1
TTGGGCGTTGACTGGTCTCGGGGACAACACCGTCATCAGGAGCGTCCAAG
TTCTTGAACTCCAAGATGGTAACGATTCCAATGACTTCCTCGAAGATAAC
CAAGTCCTCCTCGTCATGGGATCCCTTAACCTCCCCAACTTTGGCAACGT
CTCTGCCGCAACCTTCAATGGCACAGACTGGAAGCCCCTATTCCTTACCA
CCACTACAGGCAACCGACCGGGGACAATTGCCTCCTTGTTCTCTCAGAGA
CAACAGAAATTTTCACCTGGAGGCAAAAAAACTAGCGAAAGGCTTCGTAA
TCCTGATCTCCCTTGCCATCGCCCTGGGCCTTGTCTTCTTGCTCGTCTGC
TTGGGTGTGTTGGCATCATACATTCGCCGCCGCCGTGAGGGATACGTCCC
CATGCCGACTACGCCTTCACCTGGAGGGCAATCTCCGGATATGCAGGAGC
GATTACCACCTTCACATCTGT

Sequences in the Contig:

SY0AAD56YO21FM1