Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YN06FM1
Length(NT) : 511
Best Gene Model Blast : Link to GSTUMT00004001001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_05363
Accession: ref|XP_001795769.1| Score: 318 E_value: 4e-28
KEGG Definition: hypothetical protein
Accession: ang:An18g06170 Score: 302 E_value: 1e-26
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2134 Score: 166 E_value: 5e-13
PFAM Definition: PNK3P, Polynucleotide kinase 3 phosphatase. Polynucleotide kinase 3 phosphatases play a role in the repair of single breaks in DNA induced by DNA-damaging agents such as gamma radiation and camptothecin..
Pfam Number: pfam08645 Score: 247 E_value: 2e-22
Swissprot: O13911|PNK1_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0046404 = Molecular function: ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity
GO:0046403 = Molecular function: polynucleotide 3'-phosphatase activity
GO:0000718 = Biological process: nucleotide-excision repair, DNA damage removal

Sequence:
>SY0AAD56YN06FM1
TCCCCTCAACCCCAACAGTTATCGCCGACATCTCGGAAATCGTCACCATC
GCGTCTTCACCTCTTTCTTTTCCTCTACTTACATTTCGAGCATGCCTGTA
GGTAGCCCCAAACGAAGGCGCTCCGCGGATGGTTCTGCGCCTCCTGCTAA
ACGGAAGGTCCAATCTACTACTACTCAAGCGACTGTGGTAAACTTCTTCA
AGCCTGCCTCCAAGAAGGAGCCCGAACATACTATTTGGAAGGTTGTCGAT
GACACACTGCTCGTTGGGACATATTTTAATCGGGCCTCGCCGAATAAGAC
CAAACCGGCTGCGTCTGATGTAAAAAGACGGGTTGCTGGGTTCGATCTGG
ATTCTACACTGATCACGACAGAATCGGGGAATGTGTTTGCTAAGACCGCC
ACAGACTGGAAATGGTGGAGTCCATGCGTTCCAGATACTTTGAGGAAACT
TCATGATGATGGATACATTATCGTTATATTTACAAACCAGGGTTTCCTCA
AGCAGCCAAAA

Sequences in the Contig:

SY0AAD56YN06FM1