Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YM22FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00008285001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: histidinol-phosphate aminotransferase
Accession: ref|XP_001539124.1| Score: 529 E_value: 2e-52
KEGG Definition: hypothetical protein
Accession: ncr:NCU06360.1 Score: 509 E_value: 2e-50
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0633 Score: 469 E_value: 6e-48
PFAM Definition: Aminotran_1_2, Aminotransferase class I and II..
Pfam Number: pfam00155 Score: 267 E_value: 2e-24
Swissprot: P56099|HIS8_CANMA

Sequence:
>SY0AAD56YM22FM1
TTGGAGCATACATCGACTTTGCACCCGAAGGAAGCAGTCTCGCCCCATGT
GTCGTCGACCACCCAAACCTCGTCGTTATGCAAACTCTATCTAAAGCCTT
CGGACTCGCAGGAATTAGACTCGGCGCGGCGTTCACGGCTCCGGAGATAG
CGCGGTTGTTAAACAACCTCAAAGCTCCCTACTCTGTTTCCTCCACGACC
TCTTCTCTCGCCATGGCCGCGCTTTCCCCCGCAGGATTGGCCGTCAAGAA
CGAGAATGTGCGTAGATTGTTGGTGCAGCGCGATAGGATTATTTCTGAAC
TTCCAGAGTTGCCGGGGATCGGGAGGTTTTTGGGCGGGTTTGATAGTAAC
TTTTTGCTGGTTGAGATTCTTGATAATAACGCGGTTCCGAATAGTGGGGT
TGCGAAGAAAGTGTATGAGCAACTTGCGGAGGAGCATGGGGTTATTGTTA
GGTACCGTGGCGGGGAGGCTGGGTGTACAGGTTGTCTTAGGATTACAGTT
GGCACCGAGGCGGAGGTTGGGAGATTGTTGAAGAAGTTGCGGGAGACGCT
TAACGCGGTTAGGGGGGAGTAGATATGTTACAAGTATCATACTTGAAGGT
GGATTTTGCCCTTGAT

Sequences in the Contig:

SY0AAD56YM22FM1