Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YM07FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00008720001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_04818
Accession: ref|XP_362372.1| Score: 177 E_value: 2e-11
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04818 Score: 177 E_value: 8e-12
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0037 Score: 147 E_value: 2e-10
PFAM Definition: No Hit Found

Sequence:
>SY0AAD56YM07FM1
TTGGCTCCATCATACCACTTACATCGCCTATCCAACTTTCTCCCGCAAGT
TCTCCCTTGTTCGTCCTACTAGGGAGATATATTCCGGCGCCAAAAAAATG
GCCTACTATAATTCGAATCCTGATGCTCTCCCAGCGTAAGCATGCTTATC
CCAGTCCCTTTCCATACTAGACACCATTCTCCCCGATTACTTTGTTTCTT
TTCTATGGGAGACTCGCTAACCTTCTCTATATCATTTACACAGCCACGCA
GAACCGGAGCAAGCCGCCCAGATGATGAGCGGCGGATACGAAAACCGTCC
CCCTCCGAATCGCCCACCTCCAGTGGGATCAAACTACGGAGGTGGCGGTG
TGAAGCCAATGTCCCCCCGCCCGGACCCGTACCGCCAGCAGCAAGGACAC
CAGGGGTATAACCAGCCACCGCCCGGGCGACCCCAGCAGTTCCAATCCCC
ACCTCCGGGGCAATTCGGTGGCGCTGGACAGCGGCCTCCACCGGTTTCAA
GACCTCCGCCCACGCCTGCCCCAGCCCAGGGGGTCGATCCGACGTTGTTC
CCGCTATTTAAGGCTGTGGACAAGGATGGCAGTGGACAACTGAGTGAGAA
GGAGCTTCGAGCTGCACTCGTCAATGGGGATTGGACTTCCTTTGATCCTC
ACACTGT

Sequences in the Contig:

SY0AAD56YM07FM1