Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YM01FM1
Length(NT) : 598
Best Gene Model Blast : Link to GSTUMT00005326001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_07018
Accession: ref|XP_001224674.1| Score: 728 E_value: 2e-75
KEGG Definition: hypothetical protein
Accession: ncr:NCU04327.1 Score: 722 E_value: 4e-75
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0477 Score: 731 E_value: 2e-78
PFAM Definition: MCM, MCM2/3/5 family..
Pfam Number: pfam00493 Score: 534 E_value: 1e-55
Swissprot: P40377|MCM2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0042555 = Cellular component: MCM complex
GO:0005656 = Cellular component: pre-replicative complex
GO:0005515 = Molecular function: protein binding
GO:0006270 = Biological process: DNA replication initiation
GO:0000084 = Biological process: S phase of mitotic cell cycle

Sequence:
>SY0AAD56YM01FM1
TTGGGGCACGTTGTGCGATCATCGCAGCGGCGAATCCGATAGGGGGACGA
TACAATTCGACTATCCCCTTCGCTCAAAACGTTGAACTAACAGAGCCCAT
CCTATCTCGTTTCGATGTGCTCTGCGTCGTACGCGATACAGTTGACCCCG
AGGTTGATGAGCTCCTTGCAAAGTTCGTTGTCGAGTCTCATGGCCGCTCC
CATCCAGTGGGAAATAGTTCCGCCACTCCCGCAGCTAGCAGTGACAGAAA
CACAAACTCCCCGATCCCGCAGGAGTTACTCCGGAAATACATTCTTTACG
CCCGAGAACACTGTTCTCCCCAGTTACATCAGATGGATCAAGATAAGGTC
TCTCGGTTGTTTGTGGAGATGCGTCGTGAGTCCCTTGCAACAGGGAGCTT
CCCGATCACTGTGAGACATCTGGAAAGCATTATCCGGCTATCGGAAGCCT
TCGCGAAAATGAGGCTAAGTGAATACGTCCACTCAAAAGATATCGACCTT
GCCATTGCTGTTACGGTTGACAGCTTTGTTGGTGCGCAAAAGGTCTCTGT
TAAGAAGAGTCTTGCGAGAGCATTTGCGAAGTACACCTTGCCTGGGGG

Sequences in the Contig:

SY0AAD56YM01FM1