Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YL13FM1
Length(NT) : 460
Best Gene Model Blast : Link to GSTUMT00001225001 E-value : 1e-83
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 193 E_value: 1e-13
KEGG Definition: Pfs, NB-ARC and Ankyrin domain protein
Accession: afm:AFUA_8G06400 Score: 190 E_value: 1e-13
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 171 E_value: 1e-13
PFAM Definition: No Hit Found
Swissprot: Q53RE8|ANR39_HUMAN

Sequence:
>SY0AAD56YL13FM1
TTGGCAGGTCAAACACCACTCCATTGGGCTGCTTGGGGTAGGGACCAAGC
AATAGTAAAAATACTACTCGGACGGGACGACGTCGACCCCAACAAACCAG
CCCACGGTGGCATAACAGCACTCCATTGGGCTGCTTATCGTGGGCCCGAG
GGACTGGTGACACTACTACTCGCACGGGGCGACATCAACCCAAACCAACC
AGATGATGCCGGCGGAACACCACTCAATCTGGCTGCTCAGCTCGGCCATG
CCGGTGTGGTAGCGCTACTACAGCCGCTGGCATCTGTCACCCCTGGTCCG
GCCTGAGCCCGTAGAGGTATCCTTCCACCTCCCCCTTCGAACCTGGATAC
CCTATGTCCCATTTTTGCCACGGCCCCGACAGTTCCGTAATCACATTTTG
TCGACCTTGCCTTCCTCTCTTCACACCCCCCCCCCGCCCCCTCCGGCGAT
TTAAAACATG

Sequences in the Contig:

SY0AAD56YL13FM1