Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YK21FM1
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00007763001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Highly conserved, iron-sulfur cluster binding protein localized in the cytoplasm; forms a complex with Nbp35p that is involved in iron-sulfur protein assembly in the cytosol; Cfd1p
Accession: ref|NP_012263.1| Score: 608 E_value: 2e-61
KEGG Definition: CFD1, DRE3; Cfd1p
Accession: sce:YIL003W Score: 608 E_value: 8e-62
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG3022 Score: 572 E_value: 8e-60
PFAM Definition: No Hit Found
Swissprot: P40558|CFD1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0051539 = Molecular function: 4 iron, 4 sulfur cluster binding
GO:0016887 = Molecular function: ATPase activity
GO:0005515 = Molecular function: protein binding
GO:0016226 = Biological process: iron-sulfur cluster assembly

Sequence:
>SY0AAD56YK21FM1
TTGGCACTCCCATTTGCAACTGCCTTCTCTGTCTTCGCCAACAACTTTTC
CGTAATCCCCTCAAACACCGGGAAAAGCTTCGATTCTCCATACCTCTGTA
GCAGCCCCACCTCATCCGTCGTCTCCTTCTGTCTCTCGAGCATAAGATTG
AAGGCCGGATCAATCGGCACGGCGCCGAAAAAGTCCACGCCAAACTGCTC
CGCCATGACGGCACCACCGCCGCTAGAGAAGATGTTCGTGCAGGTGGAGC
AATGTGGACACACGAAACCACTCATGTTCTCGATCACGCCGAGGATGTCA
AGCCCGACCTTTTTGCAAAAGTTGAGCTCCTTGCACACGTCTGCCGTGGA
AATTGCCTGTGGGGTCGTCACGACAATGGCGCCGTCGGGGGATACGCTGC
GGAGCTGCTCTGCTAAGGAGATGTGTTCGTCGGAGGTCCCTGTCGTGCAC
CTCGTATCAACATCGACAGGGGCAAACGAGAGAGGGGGAAGAGAAAGAAT
ACCTGGCGGAGTATCAACCAATAAATAATCCACATCCCCCCACAGAACGT
CGGTAAGGAACTGCCTGACCATAGCCGTCTTCTTAGGCCCTCTCCAAACA
ACACTATCTCCCCGATCTCGAAGCAGGAAACCCAAACTCATACACTCG

Sequences in the Contig:

SY0AAD56YK21FM1