Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YI19FM1
Length(NT) : 513
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: TatC, Sec-independent protein translocase protein (TatC). The bacterial Tat system has a remarkable ability to transport folded proteins even enzyme complexes across the cytoplasmic membrane. It is structurally and mechanistically similar to the Delta pH-driven thylakoidal protein import pathway. A functional Tat system or Delta pH-dependent pathway requires three integral membrane proteins: TatA/Tha4, TatB/Hcf106 and TatC/cpTatC. The TatC protein is essential for the function of both pathways. It might be involved in twin-arginine signal peptide recognition, protein translocation and proton translocation. Sequence analysis predicts that TatC contains six transmembrane helices (TMHs), and experimental data confirmed that N- and C-termini of TatC or cpTatC are exposed to the cytoplasmic or stromal face of the membrane. The cytoplasmic N-terminus and the first cytoplasmic loop region of the Escherichia coli TatC protein are essential for protein export. At least two TatC molecules co-exist within each Tat translocon..
Pfam Number: pfam00902 Score: 105 E_value: 7e-06

Sequence:
>SY0AAD56YI19FM1
TTGGTCGCATCACATCACCTTGCAGCCGCTATACTGTACACAACATTGAG
TCTCCCTACTATACTATACAGGCTTCCGTCTTGCTTGTCGTGAGGGAAGA
GAAAAGAGAAAGGGAGAAAAGAGAGAAAAGAGAGAAAAGAGAGAAAGAAA
GAGAGGGGCCTTCACTGCTGTGATACCTCTATTCTAGCCCACCCGCTCCC
TTGGGGATTTCCGGGGAAGGTCTATTTTTTTATTTTTATTTTATCCCCAT
TTTCATTCATTATTTCCTTTTACCCTCTCATTTTCTCCAGTTCCCATTTT
ATTCATCCTGTCTTGTCTTTTTTCTTACCTTTCCTTTCGGATTATTATTA
TTATTTATTTTTTCCTGTTTTTTTTTTTTTTTTTCGTTATTCAGGGAGAG
AGGAGGATATCGGCACATTATACATACAGTATTTATATATATTTTTTCTT
TCCTTCGAGAATCGTGCTTTAGAAGGAACCCCCCCCCTCCACTCTCTATC
TTCCCTCGCACAA

Sequences in the Contig:

SY0AAD56YI19FM1