Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YG03FM1
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00005204001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_00467
Accession: ref|XP_368777.1| Score: 429 E_value: 8e-41
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00467 Score: 429 E_value: 4e-41
KOG Definition: No Hit Found
PFAM Definition: DUF1941, Protein of unknown function (DUF1941)..
Pfam Number: pfam09161 Score: 418 E_value: 4e-42
Swissprot: O74447|YCG2_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAD56YG03FM1
TTGGCGCACGAGCGATCACACTGCATTAAAATAGCGGCTAGTCTTCTGCA
CAAATACCCGCCGTCCCTCCTCTTCGGGCCAAAGGCGCTAGGCAAAGCAC
CGATCAACGAGGAAAAACCATTCGTGTACTTTTTTATGCAGCTGGTTCTC
ATTGATCTTCGTGCTACGTTTCCAACACTACTCGAACAGCTCGCTACTCC
TTCATATGGGAGTACTGCTCACAGATTGGCTTCTGATTTTGATGTACTGG
CGGCATTCTTGGGATACCTGCTAATGGTCGAGGACTTTGATGATATACCA
ATCACGCCAGATTTACTGCTAAAGCTGAAAGCGGATATCGGGGAGACTTT
CGGACTTACCCTGGAGTTCTTGCGGGATCGTTGGGATGCTGGGTACGCTG
GCGCCGCCGGCTTCGAACCTGGCTTCGAAAAAGACACCCCATTGAGTATA
ACCTGGGAAACCAAGCTCGAAGGTGGAATTGCGCGCGACCCATTGGTGAT
TGCAGCTGTCAGGGCGCTATCCCTCTGGCTGAAAGAAGATGAAAGCCTAA
GAAAAGAATCCGGAGGCCTAACAGACCTCTTCTT

Sequences in the Contig:

SY0AAD56YG03FM1