Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YF01FM1
Length(NT) : 569
Best Gene Model Blast : Link to GSTUMT00002741001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: WD-repeat protein mip1
Accession: ref|XP_001539899.1| Score: 740 E_value: 6e-77
KEGG Definition: hypothetical protein; K07204 regulatory associated protein of mTOR
Accession: spo:SPAC57A7.11 Score: 726 E_value: 1e-75
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG1517 Score: 767 E_value: 1e-82
PFAM Definition: No Hit Found
Swissprot: P87141|MIP1_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0031931 = Cellular component: TORC1 complex
GO:0005515 = Molecular function: protein binding
GO:0031137 = Biological process: regulation of conjugation with cellular fusion
GO:0031929 = Biological process: TOR signaling pathway

Sequence:
>SY0AAD56YF01FM1
TTGGGCATCGTCTTAGAGCACTCATTTTGCTCAGTAAATTCCTCGATTTG
GGTCCCTGGGCTGTGAATCTGGCATTGAGCATTGGTATTTTCCCCTACGT
GCTTAAGCTTTTGCAGTCGGCGGCGCAGGAATTGAAGCCCGTGATGGTGT
TTATTTGGGCGAGGATATTGGCCGTCGATGCTTCCTGCCAGGCGGATTTG
TTGAAGGATAATGGGTACAGCTACTTCATCCAGATCCTCAGTCCAGCCTC
TGGAATCCCTGTCGGAAACGCAAGTGAACATCGCGCTATGTGTGCTTTTA
TTCTCGCCATGTTCTGCAGAGGATTTCACCAGGGCCAGGTGGTCTGCATG
CCTCCGAATGTTATGGGCGCATGTCTTGCCCACCTTGGAGACGAGAATCC
ATTGTTGAGGCAGTGGGCATGTCTCTGCTTGTCACAACTTTGGCACGACT
TTGCCGAGGCCAAGTGGCAAGGCATCAGGGAGGGTGCACACTTAAGACTT
TGTGAACTTGCTACGGACAACGTTCCGGAGGTCCGGGCGGCGGTATTGTA
TGCACTCACAAGTTTCTTA

Sequences in the Contig:

SY0AAD56YF01FM1