Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YC22FM1
Length(NT) : 519
Best Gene Model Blast : Link to GSTUMT00008882001 E-value : 8e-64
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_501810.1| Score: 177 E_value: 9e-12
KEGG Definition: hypothetical protein
Accession: yli:YALI0C13904g Score: 177 E_value: 5e-12
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1932 Score: 139 E_value: 8e-10
PFAM Definition: No Hit Found

Sequence:
>SY0AAD56YC22FM1
TTGGTACAATTATAATATAGATTCTATATTCTATATTTTTTTTTTCCGGA
GAGGAGGGTCTACATGGGATGCAAGCCCTGAGCATCAGGGCTTAGGAGGA
GTCGAAAAAAAAGTCATCACCTTTTCCCTTGCTTGTTTCCTTCTCTCCTC
CTCCAACCCAACCAACACTCTGCCCCACAACCAACATTCGACAACTCAAA
AAACAGTCTTCAAGGTCAGTGCCATAATTGCTTCCAAACCTAGCGCCAGG
ATGCCCGCCGCTACAGAGCCCAGCGCCACTGGGCACTCACAAAACCTGGG
TTCACAGTCGACCCAGGCGCCCCCCCCACCACATCCACCTGTTTTCTATA
GCCGGGGATTTAACATAGGCCATCAGAAGGTCGGATTGGATGTTAACATG
GCGAGCAAGACGTTGAAGGGATGGTCCGAAATCACGGTCTACCCAACAGA
TGCTTCATTGCGACAATTTAGATTGAACTGCAGACAGTGCAGGATTACTA
GATGCTATGTTAACGGAAG

Sequences in the Contig:

SY0AAD56YC22FM1