Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YB24FM1
Length(NT) : 505
Best Gene Model Blast : Link to GSTUMT00005271001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_06181
Accession: ref|XP_001242285.1| Score: 326 E_value: 3e-56
KEGG Definition: stationary phase-induced protein, SOR/SNZ family [EC:4.-.-.-]; K06215 pyridoxine biosynthesis protein
Accession: aor:AO090701000725 Score: 330 E_value: 2e-55
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG1606 Score: 356 E_value: 5e-35
PFAM Definition: SOR_SNZ, SOR/SNZ family. Members of this family are enzymes involved in a new pathway of pyridoxine/pyridoxal 5-phosphate biosynthesis. This family was formerly known as UPF0019..
Pfam Number: pfam01680 Score: 361 E_value: 2e-35
Swissprot: Q9UW83|PDX1_EMENI

Sequence:
>SY0AAD56YB24FM1
TTGGGGACTACCTACCATAGCACACGGTTCAATCATTTGGGCTTCCTTCC
GCTAATTAACCTTTAACTAATATGTCTACCGCATTGCCCGTTAATGGTAA
TCACGAGCGTAGTGCTCCATCAACCGACTTTACTGTCAAGACTGGCCTTG
CTCGTATGCTCAAAGGAGGTGTCATCATGGACGTTGTTAATGCAGAGCAG
GCGAGAATTGCTGAGGAAGCTGGTGCCTGCGCTGTTATGGCACTCGAACG
TGTCCCCGCTGATATTAGAGTCCAAGGTGGTGTTGCCAGAATGGTCCGAC
CCCAAGCTTATAAAGGAGATTATGGAGGCTGTCACCATTCCTGTCATGGC
AAAGGCGAGAATTGGTCACTTTGTTGAGTGCCAGATTCTGGAGGCTTTGG
GTGTGGATTACATTGACGAATCTGAAGTTTTGACACCCGCCGATAATACC
CACCATGTTGTTAAGCATGGCTTCAAGGTTCCCTTCGTCTGTGGGTGCAG
GAACC

Sequences in the Contig:

SY0AAD56YB24FM1