Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YB12FM1
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00007657001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein HCAG_03469
Accession: ref|XP_001541372.1| Score: 467 E_value: 4e-45
KEGG Definition: hypothetical protein
Accession: yli:YALI0F29645g Score: 448 E_value: 3e-43
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG1268 Score: 204 E_value: 3e-17
PFAM Definition: No Hit Found
Swissprot: P53871|YNT1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0006751 = Biological process: glutathione catabolic process

Sequence:
>SY0AAD56YB12FM1
TTGGGCAGGCGATGCTCGGGACAATTCGAAGGTTGAATGAATTATTGGAT
GAAGCCGGAACCGGAGAGCCAAGCCTTTTGAACTTTGCGGCTACGGATGG
ACACTCGGTCGTTTGCACACGGTACGTCTGCTCGAGGACCGACGAGGCAG
CGAGTCTGTACTTTTCGAGCGGAACGAGGTTTCACGAGTATAAGGAGGGA
GGCTTCTATCGTATGGAGAGGCATGATCGCGGGCAGGACTTGGTCATGGT
TGCCAGTGAGCCTTTGACCTTCGAGCGAGGCGACTGGGTCACCGTGCCTA
CAAATAGCATCTTAACAATCAACAAACAGACAGTTTTGATACACCCCATC
ATTGACAAATACTACCAACAAAACCCTGCCTATAGTCGCTCCGCCGCCTT
TGTCGAGAGCAAAGGCATGGTAGCCGAACCCATTGTCCCGAGCAAGCCTG
TCAAGAATGATACCAAGAAGCCTAGTGCTATGAACGGGAAAGATGCGTCT
TATTGATACCGACAGAACCCCCCTCGGGGTCTGACGAGGGTGAATGAATT
AGCGAACGGACCGATTGACCAGACTGGGACCGGAGCACTTATGATTCATT
GATTGGATTATAGCAGTGGTGTTTGACCTTGTTTATGCTTGGTGGTGGTC
GT

Sequences in the Contig:

SY0AAD56YB12FM1