Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD56YB09FM1
Length(NT) : 461
Best Gene Model Blast : Link to GSTUMT00001374001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 193 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: fgr:FG09640.1 Score: 182 E_value: 9e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>SY0AAD56YB09FM1
TTGGGGATGCCTTGGATGAGTGTGAAGAAGTGACTCTGGTTCAGCTCGTC
CGTCGCATAACCCATCTCCCCAGATCGCAAACCTCCGGTACACCATTGAA
GTTCATTGCCACAAGTCGCCCGTACCACAGGATCGAGAAAGAGCTGGACC
CCCAAACAACGACGATCCGGTTAAGGGGGGAAGACGAAGTCAACTCCACC
ACCGCTGATGTTATCCGAGTTATAGATAATGGGATAAAAGAGCTCGAGTT
AGTCTGGGAAAACCCTGGAGGACTGGAATATTTGCGTAATCTCCTCGAGG
AGGCTGCCGACCGGACGTTCCTTTGGGTTTCTCTTGTTCTCGAGATTTTA
AAGGACAGTGAGGATTGCTCGCGGGAGGAATTTACCGATATTGTCTCCAC
TGCTCCGCGCGATCTGGCAGAATTTTACACCAAAATTCTTGATAAAAGCA
CCGACGAAGAC

Sequences in the Contig:

SY0AAD56YB09FM1