Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YO18FM1
Length(NT) : 608
Best Gene Model Blast : Link to GSTUMT00007769001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN1988.2
Accession: ref|XP_659592.1| Score: 474 E_value: 5e-46
KEGG Definition: hypothetical protein
Accession: ani:AN1988.2 Score: 474 E_value: 3e-46
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2286 Score: 183 E_value: 8e-15
PFAM Definition: Sec6, Exocyst complex component Sec6. Sec6 is a component of the multiprotein exocyst complex. Sec6 interacts with Sec8, Sec10 and Exo70.These exocyst proteins localise to regions of active exocytosis-at the growing ends of interphase cells and in the medial region of cells undergoing cytokinesis-in an F-actin-dependent and exocytosis- independent manner..
Pfam Number: pfam06046 Score: 259 E_value: 1e-23
Swissprot: P32844|SEC6_YEAST
Gene Ontology:
GO:0005934 = Cellular component: cellular bud tip
GO:0000145 = Cellular component: exocyst
GO:0005515 = Molecular function: protein binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0006893 = Biological process: Golgi to plasma membrane transport
GO:0006904 = Biological process: vesicle docking during exocytosis
GO:0006906 = Biological process: vesicle fusion

Sequence:
>SY0AAD55YO18FM1
TTGGGAAGTCTTGTTGTTCGTCTTGCAAAAATCATCGACTCTGAAGAGCG
GTCCGACGAGAAGGTCCTAGCTCTTCAGGAAGCCCAAAATAATCATCAGG
ATCTAGCTACAAGGTTCAAATCGATACAAAAAGGGCCAAAAGTAGCCCGA
GGATATAAGGGAAAGTTCCTCGCCTGCGTAAAAGCCGCCGCTCAGGCTAA
ATTTGACGCTGCGAAGGAGCGATTCGAAGACAATCCAGAAGGCCTAGAAG
AGTGTCTGGGCTGGTACTTTGGCGATCTGCAAACCGTCAAAACAGAGTTC
GTCCAGTTGATGCCCCGGCGCTGGAAAATCTTCGACACATACCTTGAAAT
CTACCACAGCTTGATGCACGACTTTCTCAAAGTCCAAATCGAAAAGCCCG
ACCTCGACGGCCAAAGTTTACTAAACATCATCCTGTGGAACGGGGAATAT
AATAAGGGCATGAAGGCACTCGGCATCAAAGCAGCTGAACTGAAGCCTCA
ACTCATTGACGGTCGAGAGGCGGAGCTACTGAAGGAATACTCCCAACTGA
TCGTCAAAAAGATGGAAGAATGGATGAATAAGATAACGGAGGACGACACA
AAGGACTT

Sequences in the Contig:

SY0AAD55YO18FM1