Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YO17FM1
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00004894001 E-value : 1e-127
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2977 Score: 130 E_value: 1e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAD55YO17FM1
TTGGCGGACCACGGCGCTATGGCGTTGAATAACTTGGGCGGTATATGGGG
ACTGACGACCTCCACTACCACCACACTTCCTCCATTCCTGACCACATCCA
TTCCCTTATTCTGCCATTTTTTGTTTGATTATTTCCCTTCTTTTCCCCCC
CTTTCCTGTACCACGAGCCACGGCGTTGCTAGCCGAGTTCCTGGAATACT
CCATTCGCCCGTAATGGGCGAAGACACACCCTTCGGTTTGTTGGCATCCA
GCTTGCAGAATGCTTCTGCCGCCGTCGTTCTCTGCGGATTTCTGGGGTTC
CTTGGGTTGGGGATTTTAGCTGTAAGATGATCTAATTTACTCCCCAGAGT
AGCAGCGTAGTGTCTTATGGAGGCTAATTGGGCTCCTGGATACATATAGT
CTTATATTCTCACCCTACTTGTCGCGCATACTCCCCGTCGCGAGACATCC
TCAGAAAGAACTTACCGGACCATCACAAAGGACGGGAAAACCACATCAGC
ACTTCCCTTACCAGATACGTATTCGAGTGGGAAAGCAGAGGTTGCCCTCT
CAGTAGTGGTTCCCGCTTATAATGAATCAGAACGATTGCCAGATATGCTG
GCTGAAGCCGTGACCTTCCTCCATGACG

Sequences in the Contig:

SY0AAD55YO17FM1