Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YN20FM1
Length(NT) : 548
Best Gene Model Blast : Link to GSTUMT00001154001 E-value : 1e-171
Numbers of ESTs : 1

Blast Results:

Nr Definition: cytochrome c
Accession: ref|XP_001538333.1| Score: 498 E_value: 6e-49
KEGG Definition: CYTOCHROME C
Accession: ncr:NCU01808.1 Score: 472 E_value: 3e-46
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3453 Score: 419 E_value: 3e-42
PFAM Definition: Cytochrom_C, Cytochrome c. The Pfam entry does not include all Prosite members. The cytochrome 556 and cytochrome c' families are not included..
Pfam Number: pfam00034 Score: 137 E_value: 1e-09
Swissprot: P00048|CYC_NEUCR
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix

Sequence:
>SY0AAD55YN20FM1
TTGGCTTTGATAGACATGGGTTTCCAAGAAGGCGATAATGCTAAGGGTGC
GAACCTTTTCAAGACCCGCTGCGCTCAATGCCACACCCTCGAGGCCGGCG
GCGCGAATAAGGTTGGTCCTAACTTGCACGGTCTGTTTGGACGTCAGTCC
GGACAGGTAGAGGGTTTCTCCTATACCGATGCGAACAAGCAGAAGGGCGT
TGTCTGGACCGAGGAGACCTTGTTCGATTACCTCGAGAACCCGAAGAAGT
ACATTCCCGGAACCAAGATGGCTTTCGGTGGGTTGAAGAAGGAGAAGGAC
AGGAATGACTTGATCACGTATGTTTTCCTTCTTCCGCGATATCCTTCCCG
ATATTTCAGGTTGATACAACAACTGATGCTTTATGTGCCTGATAGCCACC
TGCGCAAAAATACTAAATAAGCCTTTTAATGTTTTTTTTTTTCCTGCTCC
ACTCGTAAAGCAAAACCTTATAGAACTCATCTCTACTCTTTCGTTTTTTT
ATATTTCACTTTGTCGGTGTATCTGAAGTTGGTGGTTCCATGCGAACG

Sequences in the Contig:

SY0AAD55YN20FM1