Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YN10FM1
Length(NT) : 609
Best Gene Model Blast : Link to GSTUMT00011239001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06796
Accession: ref|XP_001592555.1| Score: 676 E_value: 2e-69
KEGG Definition: hypothetical protein
Accession: mgr:MGG_13154 Score: 628 E_value: 4e-64
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2574 Score: 534 E_value: 2e-55
PFAM Definition: Nop, Putative snoRNA binding domain. This family consists of various Pre RNA processing ribonucleoproteins. The function of the aligned region is unknown however it may be a common RNA or snoRNA or Nop1p binding domain. Nop5p (Nop58p) from yeast is the protein component of a ribonucleoprotein protein required for pre-18s rRNA processing and is suggested to function with Nop1p in a snoRNA complex. Nop56p and Nop5p interact with Nop1p and are required for ribosome biogenesis. Prp31p is required for pre-mRNA splicing in S. cerevisiae..
Pfam Number: pfam01798 Score: 319 E_value: 1e-30
Swissprot: Q5U5C5|PRP31_XENLA

Sequence:
>SY0AAD55YN10FM1
TTGGCTACGCCGTGAGATTTCCTGAACTGGAAAACTTAGTTACCAATCCT
TTGGACTATGCTAAGACAGTTTCTATAATCGGTAACGAGTTGGACATCAA
AAACCTTGAGGCCCGTAACGGGAATCGGCTACGACAGGTCTTGGATGGGC
CGACGTTGATGGTGGTGACAGTTGAAGCTACGACCACCTCCGGTCGCGAC
TTGACGGAGAAGGAGTTGACGGTCACAGTGAGAGCCTGTGAAATGACACA
AGCCCTTGACTCAGCCAAACGAACCATCACGGCTTACGTCGAATCTCGAA
TGTCCATGTTCGCCCCTAATACCTCTGCTATTGTTGGCTCTCAAACTGCA
GCTCAGCTCATCAACTTTGCCGGTGGGCTGCGCGGTCTTGCTGCTACACC
AGCTTGCAACATTGCTGCTCTAGGGTCTAGACGCCAGACTCAAACGGGGC
TAGCAACAAACATTGGCATTCGACAACAGGGCTATATATTTCACTCACCT
ATAATTCGGGAAATACCTACGGACCTAAAGGTTCAAGCCATGCGAATAGT
ATCCGCGAAACTTATCCTCGCGGCTCGAGTTGACTTCTCGCACTCATCTC
CTGATGGAT

Sequences in the Contig:

SY0AAD55YN10FM1