Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YN03FM1
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00008603001 E-value : 1e-120
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU06076
Accession: ref|XP_959424.2| Score: 255 E_value: 1e-20
KEGG Definition: hypothetical protein
Accession: ncr:NCU06076.1 Score: 264 E_value: 5e-22
KOG Definition: No Hit Found
PFAM Definition: DUF1748, Fungal protein of unknown function (DUF1748). This is a family of fungal proteins of unknown function..
Pfam Number: pfam08520 Score: 269 E_value: 8e-25
Swissprot: Q10167|YAUE_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAD55YN03FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTACAATCCAACCATCCTT
TTCCACCCTTCATCACCAACCGAACCGGTAGAAATCCGCAGCCATACTCC
TCTTTCTACTACCCTGTTTTATCTCCCTGCCACTCAATATGGTACTCCTA
TTCTATTTCCCCTTCCCCTCTTCTACCCATCCCCCATTTCGACCCAGAGA
AAATGGAGCTTAGCTACATCCCCACCCCATTCCTGTTTCCACGTTCTGCA
CGCTGACATTTCCACCATCAACGCCATAAAACAGCTCGGCAAAATCGCCC
ACTACAGCTTTGACGCAATCTTATTCTCCGCCTTTCTAGCAGGCGTTAAG
CGGTCCACCGGTCTCACTTTCCAAACCGAGAAGATTGAATCCAAAGACGT
CCGCTCCGCAATCGACAAATACCTCAACATTGGAGAATGGTTTATGGATC
AGAGCATTGCCGCGATGGGCAGCAGCAATTACTTTGAGAGGAGACGATAA
TCTACTCATTCCTTTACGGCGGGGGGGTTCACGAATGATGATTGGATGGT
TTTCTCCTGTTCGACAAAAAAAGAAAAAAAGAAAACCCGTATGAAAA

Sequences in the Contig:

SY0AAD55YN03FM1