Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YM24FM1
Length(NT) : 627
Best Gene Model Blast : Link to GSTUMT00007936001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: proteophosphoglycan ppg4
Accession: ref|XP_843162.1| Score: 141 E_value: 2e-07
KEGG Definition: proteophosphoglycan ppg4
Accession: lma:LmjF35.0520 Score: 141 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD55YM24FM1
TTGGGAATAATCCTCGACAGAGCTCTGCCTTGGCAATGTTAATGTCCGGG
GCCGGAATAGGTCCTGGGCCCGGTCGAAGCGGATCTGGCATGTTCCCGTC
GTATCCTAGTGGTGACGAATTGAGTGAGGACGAGCGGACAAACCTTTCTG
ACGCGCTCACAAATCCAAGCGTACCTACAAGTCCTGTCAGAAAGTTTTCC
AACCCAGCAACTACAGCTCCGCGCACCGACGCGCATACACATCAAATGTC
CAGCAATAGCAATGCATGGATGTCTGATAGCGCGAGACCCTCAGGATCTG
TTACTTCATCAACGACAAGATTCAATGCTGAAGCTAAAGAATTTGAATTC
AAGCCAGGAGCCACCTTCAGCTTTTCTCCTAATACCCACTCTCGGAATCA
TTCTGGAAACCAGAGCACTAGTGCTTTTGGTGGGTTTGCTAGTTTTGGAA
CGAGTAACTTCAATGCTGCCGCCACCACTTTCCGCCCTAGTTTCCTGACT
GGCTCTCATTCCGGCTTGTATGAGAAAGGAGCAGTTGCCTTTAGTCCCAA
TGCACCACCATTTATGCCGAGCTCTCTTGCTAAATCAGTACCCGCTTCTC
AACATTCAAGCACTCCTTCCGCTCTGC

Sequences in the Contig:

SY0AAD55YM24FM1