Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YM20FM1
Length(NT) : 559
Best Gene Model Blast : Link to GSTUMT00003765001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001540520.1| Score: 204 E_value: 8e-15
KEGG Definition: unnamed protein product
Accession: kla:KLLA0C03740g Score: 204 E_value: 4e-15
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2967 Score: 248 E_value: 2e-22
PFAM Definition: tRNA_m1G_MT, tRNA (Guanine-1)-methyltransferase. This is a family of tRNA (Guanine-1)-methyltransferases EC:2.1.1.31. In E.coli K12 this enzyme catalyses the conversion of a guanosine residue to N1-methylguanine in position 37, next to the anticodon, in tRNA..
Pfam Number: pfam01746 Score: 122 E_value: 1e-07
Swissprot: Q6CUM6|TRM10_KLULA
Gene Ontology:
GO:0009019 = Molecular function: tRNA (guanine-N1-)-methyltransferase activity

Sequence:
>SY0AAD55YM20FM1
TTGGCCAGAATCAACGACAACCGCCACCGATCCACAAGACACCACCGAGC
TCTCCAAAAACGCACGCAAGCGCCAATTGAAAGCCAAGCGCTGGGAAGAG
ACCCGCGAAGCTTGGAAAGCCGCCAAGCGTGAGAAGAAGAAAGCACGTAG
GGCCGCGGAGCGTGCGAAGGCCAAAGCTGCCGCTGAAACAGCACAAGAAA
GTGGAGGGGAATTGTTGAAGCAGAGGGATAATGCGAGTGGCGATGGAAAT
AAAAACAACGGCTCCATGAATAGGAGGAGGCCGGTGCTGGAACCTATTAG
TTTGATTATGGATTGCGGGTTTGATGAATTGATGAGTGATAAGGAGATAA
CATCCCTCTCCAGTCAACTAACCCGCAGCTATAGCATAAACCGCACATCC
CCACGCCAAGTAACCCTCCACCTAACCAGCCTGAACAAGCGCCTCCTAAC
GCGCTACCAAACTATCCTCTCGAACCAGCACCTTCGCTGGAAAAATGTCA
TTGTGTCCTCCGAGCCGTACGAGGTGACTTCAGACCTGGTATACCTAACC
GCCGACTCA

Sequences in the Contig:

SY0AAD55YM20FM1