Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YM03FM1
Length(NT) : 595
Best Gene Model Blast : Link to GSTUMT00006720001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An12g05680
Accession: ref|XP_001395633.1| Score: 171 E_value: 6e-11
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 171 E_value: 3e-11
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 145 E_value: 2e-10
PFAM Definition: No Hit Found
Swissprot: Q9ZU96|Y2168_ARATH

Sequence:
>SY0AAD55YM03FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCAGCAGACCAGACTTA
CGAATGCGTCGTGCGAGCATTGTTAGAAGACGCCAGGGTGGCAATCAACT
ACAACAGCTCCAGCAGTGGCACTCCGTTGCACGTTGCAGCAGTGAGGGGT
TCCGCGGCAGTAGTCGAACTTCTTCTGGGCGACCCGAGGGTGCAGGTCAA
CCTGCGCGACGGCAATGGCAATACCGCACTGCACCTCGCAGGCAGTCAGG
AGCACGAACAAATCGTGTCGCTGCTGCTCGCGCACAAGGACATCGACGTG
AATATTCCAAACAACGGCGGATGCTCAGTCAGGAACCTGGCGGATATCCC
CTCCCACTATCCCTCTAACATTCAGAAGTGGGTTCTGGCTCATGATGCCA
AAGGGAGAGTGAATGTGGGATGTCTCGGAAAGATGTATTGATAGGGGGTG
TATCGGATCTCTCTTTTTTTCTTTCTGTTTTTTTTTTTGCAGCTGTGCCT
TTTTGTGAATATGATAGAGCGGAGCAAGGTGTGCGAAAAAAGTTAGCGAG
TGGTTTCACTTTTTTCTTTTTCTTTTTCTTTTTGTCGAGAGTTTA

Sequences in the Contig:

SY0AAD55YM03FM1