Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YJ16FM1
Length(NT) : 663
Best Gene Model Blast : Link to GSTUMT00010158001 E-value : 1e-142
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_03189
Accession: ref|XP_001595101.1| Score: 410 E_value: 2e-38
KEGG Definition: hypothetical protein
Accession: ncr:NCU00018.1 Score: 408 E_value: 1e-38
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0730 Score: 179 E_value: 3e-14
PFAM Definition: CDC48_N, Cell division protein 48 (CDC48), N-terminal domain. This domain has a double psi-beta barrel fold and includes VCP-like ATPase and N-ethylmaleimide sensitive fusion protein N-terminal domains. Both the VAT and NSF N-terminal functional domains consist of two structural domains of which this is at the N-terminus. The VAT-N domain found in AAA ATPases pfam00004 is a substrate 185-residue recognition domain..
Pfam Number: pfam02359 Score: 132 E_value: 9e-09
Swissprot: Q9P3A7|CDC48_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0000790 = Cellular component: nuclear chromatin
GO:0005515 = Molecular function: protein binding
GO:0006510 = Biological process: ATP-dependent proteolysis
GO:0007059 = Biological process: chromosome segregation
GO:0006950 = Biological process: response to stress
GO:0051230 = Biological process: spindle disassembly
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>SY0AAD55YJ16FM1
TTGGTCTCATCATTCTTCCCCCCTTAACTCCATCTCTCTCCCATCCATCA
GCACTGCTACCATATCCCACCTCGCTTCATCTCTCAAGCTCTATCTATCT
GATTTGCTCCTTCATTCTTCCTACCCAAGATGGCTGATCATGAAGAGAAA
AAGAAGGTTAATCTGGCCGATGCCTCAGGCGCCACTCACAAAGAGGTATA
AATTTCGTCTACCGTTTATCGGCCTAGCAGATGGTTGAGATTAACAAGAG
CTTTGCTAACGGGTTGGGCGCAGGCGGACGAAACCGCAACGGCAATCTTA
AAGAAGAAGAAGAAGCCGAATAGCTTGATTGTCACTGATGCCGTTAATGA
TGATAATAGTATCATCGCCTTGTCTAATAATACCATGGAGACGCTTCAAC
TGTTTCGTGGGGATACTGTGCTTGTCAAAGGGAAGAAGCGGAAGGACACA
GTCCTTATCGTTCTGGGGATGATGATCTTGATGACGGATCTGTGAGAATC
AATCGTGTCGTTAGAAACAACCTCCGGGTTAGACTGTTTGTCTTCCCAGC
ATGGTTCTGAAATCTATTCCGGAAACTAACCTAGGCGTAGTGGCGATGTC
ATTACCGTACACCCGTGTCCTGATATTAAATACGCGAAACGTATTGCCGT
TCTCCCTATTGCA

Sequences in the Contig:

SY0AAD55YJ16FM1