Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YH10FM1
Length(NT) : 609
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12928
Accession: ref|XP_001586350.1| Score: 543 E_value: 5e-54
KEGG Definition: hypothetical protein
Accession: ang:An04g04060 Score: 425 E_value: 1e-40
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q4ING3|CCPR_GIBZE
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004130 = Molecular function: cytochrome-c peroxidase activity

Sequence:
>SY0AAD55YH10FM1
TTGGTTTCCTTCAGTTCACTCTTTCACTTGTCAACAAACCTCTCCTCCAT
AGTATTGAAGGCTACGACGCCACTTCCAGAGTTATCTTTCCCGCTCTCAA
ACAAAATCAACAACACCTTCATCATGGCTTCCACAGCACGAACTTTCACC
CGCGCGGCGATTAAGTCCAACCCCTCGGTCTCGGCCTTTAGAACCTCAGC
ACGCAACACAGCATTCATCTTCCCCCGTCAAGCTTTCCGTCAACAATCAA
GACGCGGATATGCATCCGAGCCCGCCAAGTCTTCCTCCTCGTCAGGTATC
TACATCGGTATTGGTGCTCTCGCACTAGGTGGCGCTGGATACTACTTCTA
TACTCAAGGCAATGGCTCTCTCCTCTCCGGTTCTGCGAGCGAGACTAAGG
GCGTCTTCACACCCAAGTTCGAGGACTACCAAAAGGTATACAACGAGGTG
GCAGCCAGATTGGAGGAGAAGGATGACTACGATGATGGTTCCTATGGACC
TGTTCTAGTTAGACTGGCGTGGCATGCTTCCGGAACGTATGATAAGGAGA
CTGGTACTGGTGGTTCGAATGGTGCTACCATGAGATTTGCCCCCGAGGGA
GACCATGGC

Sequences in the Contig:

SY0AAD55YH10FM1