Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YH08FM1
Length(NT) : 547
Best Gene Model Blast : Link to GSTUMT00011304001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001540013.1| Score: 371 E_value: 3e-34
KEGG Definition: hypothetical protein
Accession: fgr:FG02760.1 Score: 360 E_value: 3e-33
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0119 Score: 106 E_value: 7e-06
PFAM Definition: DUF1768, Domain of unknown function (DUF1768). This is a domain of unknown function. It is alpha helical in structure..
Pfam Number: pfam08719 Score: 409 E_value: 5e-41
Swissprot: Q5UR67|YR617_MIMIV

Sequence:
>SY0AAD55YH08FM1
TTGGGGACGGGACCAGTATATTTCTGGAAACCGCACGAGGTACCATTCGG
TATCTTTTCCCAATGGTACGAGGATGAATTTACCGCTCCTTTCGATGGGG
AACAAATGAGATTCGGTACAGCAGAGCAATACATGATGTATAGCAAAGCG
GTGTTATTCAACGACCCAGATACCGCGGCAGAAATAATGAAAACCATGAA
TCCCTCGACCCAGCGCGCCCTAGGCCGTAAAGTCCGGAACTTCACCGATG
TAACGTGGGCGGAGAATAGGTCCCGGATTGTGGAAGAGGGGAGTTATTGG
AAGTTCAAGAAGGATCCGAGCCGGCTCTTGGAAACGGGTGATCGGGAGAT
GGTCGAGGCGAGCCCCCGGGACAGGATTTGGGGTATTGGCTTTGGGCCCA
AGAATGCTGATGCTGGAAAGAGGGATAAGTGGGGTATGAACCTGTTGGGG
AAGGCGCTGATGGAGGCGAGGGACAGGCTCAGGAGGGAATTAGAGCCAGA
GGTGGTGGAATCGAAGGGGAAGGAGCAAGGCTAACTGAGGGACAATT

Sequences in the Contig:

SY0AAD55YH08FM1