Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YE18FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00002767001 E-value : 9e-58
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 545 E_value: 3e-54
KEGG Definition: hypothetical protein
Accession: ani:AN8457.2 Score: 483 E_value: 2e-47
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 276 E_value: 1e-25
PFAM Definition: No Hit Found
Swissprot: P46825|KLC_LOLPE

Sequence:
>SY0AAD55YE18FM1
TTGGTAATCTTGGTGTGATGTTGCATTGTCAAGGGAAGAACGGCGAGGCA
GAAGTTATGTATCGATGTGCATTAGCGGGCAGGGAGAAAACACTCGGGCT
ATATCATCGAGATACCGTCGAGAGTATAAACAATCTTGGTGCGACGTTGC
ATAGTCAGGAAAGGCACGTCGAGGCCGAGATTATGTATCGACGTGCATTG
GCAAGAAGAGAGAAAACCCTTGGGCTAGATCATCTTGATACCTTAGCAAG
TGTCAATAATCTCGGTACGGCTCTACATAGTCAAAGAAAGTACGACGAGG
CCGAGATTATGCATCGACGTGCATTGGTAGGCAGTGAGAAAACGCTCGGG
CCAGATCATCACGATACCTTAAGGAGTGCGAGTAATCTCGGTGTGACGCT
GCATTGTCAAGAGAAGTACGACAAAGCGGAGGTTATGCATCGACGTGCAT
TGGCGGGCAGTGAGAAAACGCTCGGGCTAGATCATCGAGATACTTTAGCC
AGTGTCAATAATCTTGGCGCGGCGTTGCATGGTCGAGAAAGGTACGACGA
GGCAGAGATTATGTATCGCCGTGCAATCCTGGGCAGAGGGAAAACCCTAG
GACTAGATCATCAAGATACCTT

Sequences in the Contig:

SY0AAD55YE18FM1