Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YC09FM1
Length(NT) : 712
Best Gene Model Blast : Link to GSTUMT00007009001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Autophagy-related protein 13
Accession: sp|Q0UPX4|ATG13_PHANO Score: 293 E_value: 7e-25
KEGG Definition: phosphoprotein involved in cytoplasm to vacuole targeting and autophagy
Accession: aor:AO090003000280 Score: 233 E_value: 3e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0UPX4|ATG13_PHANO

Sequence:
>SY0AAD55YC09FM1
TTGGGGGCCTTCTCCGTTAGCTGCACAGCCTATGACTCGAATTACAAGTA
GCTTTGGTTCGCGTCGGCCACGTATTGCTTCAGGTGCCAGTCGCACGGAC
GATGATAATAATAGCAGTGGAAAGGCTAGCTATTCCTCGTCGGCCGCTCC
TGGGTCCGGTCTCTACGCCGACACTGGAGCCAATTCCAATGAGGATCTGC
AAATACGAGATTTTATGAGGTTATTGGCCAATGGCCAAAATCAAACATTG
AAGAGTTTTGGAAACTCTTCAGGGGAAGCTTCGAGTAAACGGACTGGAAA
TGCATTATCAAAGTATCAGAAGATGAGAGATTCGCACATAAGTATGGCGG
ACTCCATATCATCATCCCTCCTTCTTCAGCCATCTTCGCCCTCTCCCTCG
ACATCGAGCAGACATTTGTCCAATGTTCCTGCAATGATGCCTTCGACTGA
GTTTTCGTCTTCCTCTTTACCTGGAAAGCCTATCTCTCCGCATACCCCTC
ATACGCCCGCTATCCCTTCTAGGTTGAGTGCGGGGCTGACTGCGCAGCAT
GCATCGCGGCACGGCGATCAACAGGGCCATTCAGGGAGGATATCGTTGGG
CAGTGGAGACAGGCCTGAGCGCACCCCGAGCTCTAGGGCGAGTAGTAGTT
CTCGCCTGACAACCGCTGCTACTACATCTCCCCTTGACATACCATCCTCT
CCTCGTCCTTTT

Sequences in the Contig:

SY0AAD55YC09FM1