Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YC04FM1
Length(NT) : 574
Best Gene Model Blast : Link to GSTUMT00010952001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_03341
Accession: ref|XP_001595252.1| Score: 327 E_value: 5e-29
KEGG Definition: uncharacterized conserved protein
Accession: aor:AO090120000481 Score: 299 E_value: 4e-26
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2585 Score: 139 E_value: 9e-10
PFAM Definition: YjeF_N, YjeF-related protein N-terminus..
Pfam Number: pfam03853 Score: 117 E_value: 4e-07
Swissprot: O94752|YBSB_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAD55YC04FM1
TTGGAGGACTCCGAGGATGAGCTCGGCCGAGGTCGTGGAGATGGCGCGGC
TGCAGATAGTGGAAGAAGTAGCAGAAGGGGCATGTCTCGTCGATCACAGA
GTGGTCGTCGCCGAGGCGCAAGACAAATGAGCACAAGTAATCCATCGATG
AGATCCCTAGAGAATATTCATCATCAGCCATCAAATGGTGGAGGCCTTGG
ACAAACTCCAACTAACAAGCCCGGAAAACCAACGTTACGGCTAGCGCCCA
GTGGCAAACTTTGCCCCATCGTCAGCCCACTGCAAATGTTAGATGTGGAG
AGAATTGCGGAGGTCGAGCTTTGCCTCACAGACGATATGATGACAGAAAA
TGCTGGTCGGGCTATTGCGCAGGTAGTCATTCAGGCCTTTGGAAAACGGA
TATCTGCATCAAACCATAATGCCCTCCCGGTAGTCCTTGTCTTTGCCGGA
AATCATAAAAGCGGGGCACGTGCGATAGCTGCGGGAAGGCACTTGAAGAA
TCATCATGTTCGGGTGATGGCTTGTGTTCTAGGTTTGGAACGTGAAGATG
GGTTGCTAGAGCATGTCAGGAGGC

Sequences in the Contig:

SY0AAD55YC04FM1