Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD55YA16FM1
Length(NT) : 582
Best Gene Model Blast : Link to GSTUMT00009044001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09121
Accession: ref|XP_001239500.1| Score: 196 E_value: 8e-14
KEGG Definition: hypothetical protein
Accession: ncr:NCU04588.1 Score: 196 E_value: 4e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD55YA16FM1
TTGGAGTTCAACCGTTCCGCTCATTCATTCGACCCGATGTCATTCCTGCA
GAGAGCCGGCACGAGACCACTCGTGGAGATCCTTCCAATGCCATCGAAAA
CCACAATTCATACGTCCCCTCTCGACATTAGAGAATAATCCACACATATA
CATCTCCCCGGGCCCACAAGGCACACACATCCTAACCCTCCTCCCAACCA
CGCCCCCAAATCCGCACCTATCGCTGGGAACAACCGGGGTCCTCCCGCCA
ACTCCAAACAGCTTCCACACAAATCCGCATTTCCTCACCCTCCTCCATGA
AACTCTGCGCACCCACGCTCACAATTGTCCCGAGGTACAAGCCTCCGCCG
CAACGTACGCATCTCCGGGCGGCTCAAGTATATTTGCCGCGCGCAGGACG
CACGGAACGGCGGTGAGTAAAGGTGGGAGTGGAGCTGGCGGGGCGAATTT
ACAGGGCGGAGTGGGAGGTGGTGGCGTGGGTGGGTGGGCGCATGTTTACG
ACTTGAGGAATCCACCACCGTTCGGGAGGGTTGGTGATCCGGGAGATATT
ATCGGCAGTGTGGGGGTTGATGGGAATGGAAG

Sequences in the Contig:

SY0AAD55YA16FM1