Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YP24FM1
Length(NT) : 506
Best Gene Model Blast : Link to GSTUMT00009841001 E-value : 1e-101
Numbers of ESTs : 1

Blast Results:

Nr Definition: N-acetyltransferase complex ARD1 subunit, putative
Accession: gb|AAZ10098.1| Score: 230 E_value: 6e-18
KEGG Definition: N-acetyltransferase complex ARD1 subunit [EC:2.3.1.-]; K00680
Accession: tcr:506713.40 Score: 219 E_value: 6e-17
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3234 Score: 254 E_value: 3e-23
PFAM Definition: No Hit Found
Swissprot: O74457|YCGC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0031416 = Cellular component: NatB complex
GO:0005634 = Cellular component: nucleus
GO:0045011 = Biological process: actin cable formation
GO:0000917 = Biological process: barrier septum formation
GO:0006897 = Biological process: endocytosis
GO:0007005 = Biological process: mitochondrion organization and biogenesis

Sequence:
>SY0AAD53YP24FM1
TTGGGCGATCTCGTTGGAAACACGCACGTACAGGTCGACAAAGTAGCCGT
TGTACACGCTCGTGGTGACGCGCTCGAGTTCGTCCATCATTGTCTTTGCG
AGGCCGAGGCGGCGGTAGTCGGGTGCTACGGTTACGGCGGTTACATGCCC
GTGCCAGTCCTTGGCAGTGCCCTCGGCTTTACCCATTACTAGGTTTGTCA
GTGCTGCTGTTGGATGGATAGCGGTGCCGCGGGGGGGGAGGAGGAGGGGT
GCAGCTGAGGTAGAAGCTTATATCGTAGTTTTCGGTCAGGACGTCGAGGT
TTGCGAGGTTGAGGCGGAGGAGATCGAGGGGGTGGAAGGGGCGGAGGGAG
CTCATTCTCTTTTTTCCTTTTTTTCCTTTTTTTCCTTTTTTTTAAATATA
TATTTTTTAATTCCTTTATGAGGGGGTGTTGGGTGGGGTTTGGTGGGGTG
TGTTGTTGTTGCTTAAGTGGTTTTGTGAGGCTCTTTTCGCCTTTTTTTTT
TTTCCC

Sequences in the Contig:

SY0AAD53YP24FM1