Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YP13FM1
Length(NT) : 216
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_05200
Accession: ref|XP_001795609.1| Score: 202 E_value: 9e-15
KEGG Definition: glycerol-3-phosphate dehydrogenase [EC:1.1.99.5]; K00111 glycerol-3-phosphate dehydrogenase
Accession: aor:AO090005001646 Score: 194 E_value: 4e-14
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0042 Score: 202 E_value: 2e-17
PFAM Definition: No Hit Found
Swissprot: P90795|GPDM_CAEEL

Sequence:
>SY0AAD53YP13FM1
TTGGGGGACCTTTTGCACCAGCGAAGAGGTGGGATGCTGGGTGCTGGAGA
GGGTGCTGGAGAGGGTGAATTTGTGGTGAAGGCAAAGGGTGTGATCAACG
CTACAGGCCCCTTTACCGACAGCATTCGCAAACTTGATCAAGGCGAAACA
ACACAAGAGATTGTTGCACCGAGTAGTGGTGTGCACATTGTCCTCCCGGG
ATACTACTCGCCTGCT

Sequences in the Contig:

SY0AAD53YP13FM1