Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YO12FM1
Length(NT) : 515
Best Gene Model Blast : Link to GSTUMT00004369001 E-value : 1e-136
Numbers of ESTs : 1

Blast Results:

Nr Definition: APSES transcription factor, putative
Accession: gb|EDP51876.1| Score: 209 E_value: 2e-15
KEGG Definition: APSES transcription factor, putative
Accession: afm:AFUA_5G11390 Score: 209 E_value: 9e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD53YO12FM1
TTGGGAAACCCGTTGCTCCAAGGAGCTGATATTCCGGCTTACAATGAGCT
CGTTGACATGCGCCGCCTTGGGCAGACCAATTTGGGAAGCAAAGGTGGAA
ATGAAGCGGTTCTTTTTTCCTATGTACATCTTCGAGCGCCTCTCCCACAG
TCTTTGGAAGGCTCGGAAATCTTTGGATCGATGGCACCTGAATCGTACTT
CTTGATGCGCAGAAGCCAAGATGGATACGTGAGCTCTACGGGAATGTGAG
TCTCGGTTGTCCTTTTCCTGCATTTCGGGTGGGGGGGTCTCCTTCCCCCC
CCCCTCCCCTTATGTCTCCGGGCATCCCATTCCATCAAGTTTATTCATCT
TGCCGAATGGTTATATGGGCCGAAAACTGGATCCGCATCAGTACCTCTCA
TGAGGCAGGAAGTTAACTCATTTTTTTTTTCTGGCTGAATGTAGGTTTAA
GGCCTCTTTCCCCTGGGCTAAAAAGAAGGAAGAGGATCACGAAAGGCAGT
ATGTGAGGGAACATT

Sequences in the Contig:

SY0AAD53YO12FM1