Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YO02FM1
Length(NT) : 663
Best Gene Model Blast : Link to GSTUMT00000700001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An09g02900
Accession: ref|XP_001393604.1| Score: 563 E_value: 3e-56
KEGG Definition: hypothetical protein
Accession: ang:An09g02900 Score: 563 E_value: 1e-56
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53933|APP1_YEAST
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0005515 = Molecular function: protein binding
GO:0030036 = Biological process: actin cytoskeleton organization and biogenesis

Sequence:
>SY0AAD53YO02FM1
TTGGCCCGAACCATCAGCTCAAGCACTGAACTATTACAAGTATTAGATCT
TCAACACACCAAATCAACACCTACCATCAGCGCAAACCTTGCCCTCTCAA
GTACACAAGCTGAAGCTCAGCCAGATGCCAGTGCGGCCCATAATGCCCTG
ATATCCCGATTGGCTCCATTCATGCACCGCCCTATTCCTTCGGTGCCAAT
CACCCTCTTCTTCTATAATTCCAAAATGTCACTATCTCGTAGGCTCCGGA
CATCCGATGCCGGCCATTTCTTCACCCGGGTAGCACTTCCTTTCATGCCC
ACCCATATTAAAGTCCTTGCGTCAGAGACCCTCTCCGCCAATGAAAAAGT
TGTGCTTCACCGCGCGGAAGGTTTTTCTGTTATCTCTGACATTGACGACA
CAGTAAAGCACTCCGCAATTTCGATGGGTGCTCGTGAAATGTTTCGTAAT
ACGTTTACAGCTCCACTACCTAGTCTCACTATTCAAGGTGTCGCGGACTG
GTATTCGAAGCTTGCAGAAGAACCCTATAGTGCTAATTTCCACTACATTT
CCAATAGCCCTTGGCAGCTGTATCCTGTTCTCAAGGAGTTTTTCCAAGAA
GCTGGCCTCCCGCCAGGAAGTATGCACCTGAAGCAATACTCGGGAATGTT
ACAAGGTATTTTC

Sequences in the Contig:

SY0AAD53YO02FM1