Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YN03FM1
Length(NT) : 614
Best Gene Model Blast : Link to GSTUMT00008462001 E-value : 1e-152
Numbers of ESTs : 1

Blast Results:

Nr Definition: L-threo-3-deoxy-hexulosonate aldolase
Accession: gb|ABP04235.1| Score: 202 E_value: 5e-24
KEGG Definition: hypothetical protein
Accession: ncr:NCU09532.1 Score: 208 E_value: 4e-24
KOG Definition: No Hit Found
PFAM Definition: DHDPS, Dihydrodipicolinate synthetase family. This family has a TIM barrel structure..
Pfam Number: pfam00701 Score: 105 E_value: 9e-06
Swissprot: A1KTJ9|DAPA_NEIMF
Gene Ontology:
GO:0008840 = Molecular function: dihydrodipicolinate synthase activity
GO:0019877 = Biological process: diaminopimelate biosynthetic process

Sequence:
>SY0AAD53YN03FM1
TTGGAGCTCTCGAAGCATCCCAACATCGTTGGCTGCAAGCTTACCTGCGG
CAACACCGGGAAGCTCGCTAGAGTCGCGAATGCCGCGCCAAGTGGTTTTA
TGACGATGGGTGGGTCCTCGGATTTTACCTTACAATCCTTGATTTCGGGC
GGCAAGGGCGTCATTGGCGGACTTGCAAATATCGCTCCGAGAGCGTGCGC
AGAGCGGTTGTTGCTCGCGGTGACTGGGGCGCGATTAAGGGAGGTGTCGT
CGGAACCAAGAGCTGTCTGCAAACCTATTTCGGATATGGAGGTTTTGGAA
GGCGGCCACTTCCTCGGCCAACTCCTGCTCAGGACGTAGCCTACAAAGAA
GATTTTCAAGAGTTGTTGCTTTTGGAAGAATTTTTGGAGAACGGATGCCG
CGATTCTGACATCCACTCTGAGAGAATAAAGGAATTTCCACAACTTGTTG
AGCTCGAACATATGCTTGTATAAGTTCCCTTGCCCTACCTTTTTTAAACA
CTCTTAGCAGAACTTTGTTTTTATTTTTTCTCTCTTTCGTATCGTAACAT
TTGTTCGATCGTTTGTTGCTTATCCCCCTGGGGTTTATTTATCGGATTGG
GACTGGGGATTTCA

Sequences in the Contig:

SY0AAD53YN03FM1