Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YM20FM1
Length(NT) : 554
Best Gene Model Blast : Link to GSTUMT00010528001 E-value : 1e-149
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An16g08720
Accession: ref|XP_001398170.1| Score: 301 E_value: 5e-26
KEGG Definition: hypothetical protein
Accession: ang:An16g08720 Score: 301 E_value: 2e-26
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0053 Score: 139 E_value: 9e-10
PFAM Definition: Cys_Met_Meta_PP, Cys/Met metabolism PLP-dependent enzyme. This family includes enzymes involved in cysteine and methionine metabolism. The following are members: Cystathionine gamma-lyase, Cystathionine gamma-synthase, Cystathionine beta-lyase, Methionine gamma-lyase, OAH/OAS sulfhydrylase, O-succinylhomoserine sulfhydrylase All of these members participate is slightly different reactions. All these enzymes use PLP (pyridoxal-5'-phosphate) as a cofactor..
Pfam Number: pfam01053 Score: 171 E_value: 2e-13
Swissprot: P31373|CYS3_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0004123 = Molecular function: cystathionine gamma-lyase activity
GO:0042802 = Molecular function: identical protein binding
GO:0042493 = Biological process: response to drug
GO:0019346 = Biological process: transsulfuration

Sequence:
>SY0AAD53YM20FM1
TTGGTCCAATCATCCTGCAGTTAAACGTTTTCCTCACTCTTCCTGTTGTG
AAACTTAAAACGCTCTTCCCTTGTTCGACGCCCACAAAGATATATATCGT
ACCCACTTTTTCTCCTCCTCCCCTCGGAGAAATTTTGACATTTTTCCCCC
TTAAAAGCCTCCATTCCCTCCCCTCTTTCCGCCGTCATCACCGCCACTGG
TCAACGATAAGCAAACCTTCCATCCCCCCCTTTTCCCCTTGGTTTTCACT
TAAATTTCCACTCGATCCTTCCGTCAAATCACTTCGCCATGACTATTGCC
ACTCTACCAATTGAGGACGCTCCCCGCTTCCAGAAGGACAACCGTGGCTT
TGCCACCCGTGCTGTTCAAACCGGTTCCCCCCATGATCCCATCACTGGTG
CCGTCATTACTCCCATCTCACTCTCCACTACTTTCGCTCAAACCAGCGTC
GGAAACCCAGTTGGTCTCTACGAATACTCTCGTAGTTCTAATCCCAACAG
GGACAACTTCGAGCATGCCGTTGCTGCCCTAGAGAATGCCAATTACGCTT
TGGC

Sequences in the Contig:

SY0AAD53YM20FM1